Source code for pydna.amplify

#!/usr/bin/env python
# -*- coding: utf-8 -*-
# doctest: +NORMALIZE_WHITESPACE
'''This module provides functions for PCR. primers with 5' tails as
well as inverse PCR on circular templates are handled correctly.

'''


import datetime
import itertools
import math
import re
import string
import sys
import textwrap
import collections
import warnings
import copy

from StringIO                       import StringIO
from Bio.SeqUtils.CheckSum          import seguid
from math                           import log10
from math                           import log
from Bio                            import SeqIO
from Bio.Seq                        import Seq
from Bio.Seq                        import reverse_complement
from Bio.Alphabet.IUPAC             import unambiguous_dna
from Bio.Alphabet.IUPAC             import ambiguous_dna
from Bio.SeqRecord                  import SeqRecord
from Bio.SeqUtils                   import GC
from Bio.SeqUtils.MeltingTemp       import Tm_staluc
from Bio.SeqFeature                 import SeqFeature
from Bio.SeqFeature                 import FeatureLocation
from Bio.SeqFeature                 import ExactPosition
from Bio.SeqRecord                  import SeqRecord

from pydna.dsdna                    import drecord



def _annealing_positions(primer, template, limit=15):
    '''Finds the annealing position(s) for primer on template where the
    primer anneals with at least limit nucleotides in the 3' part.
    start is a position (integer)
    footprint1 and tail1 are strings.

    ::

                   <---- primer ------>

                   <tail>
                         <--footprint->

                   TAATAAactactgactatct
                         ||||||||||||||
        acgcattcagctactgtactactgactatctatcgt

        <---- start ---->


    Parameters
    ----------
    primer : string
        The primer sequence 5'-3'

    template : string
        The template sequence 5'-3'

    limit : int = 15, optional
        footprint needs to be at least of length limit.

    Returns
    -------
    describe : list of tuples (int, string, string)
        [ (start1, footprint1, tail1), (start2, footprint2, tail2),..., ]

    '''

    if len(primer)<limit:
        return []
    head = primer[-limit:]
    positions = [m.start() for m in re.finditer('(?={0})'.format(head), template, re.I)]
    if positions:
        tail = primer[:-limit]
        length = len(tail)
        revtail = tail[::-1]
        results = []
        for match_start in positions:
            tm = template[max(0,match_start-length):match_start][::-1]
            footprint = "".join(reversed([b for a,b in itertools.takewhile(lambda x: x[0].lower()==x[1].lower(),zip(revtail, tm))])) + template[match_start:match_start+limit]
            results.append((match_start+limit-1, footprint, primer[:len(primer)-len(footprint)]))
        return results
    return []


[docs]class Amplicon: '''Holds information about a PCR reaction involving two primers and one template. This class is used by the Anneal class and is not meant to be instantiated directly. Parameters ---------- forward_primer : SeqRecord(Biopython) SeqRecord object holding the forward (sense) primer reverse_primer : SeqRecord(Biopython) SeqRecord object holding the reverse (antisense) primer template : drecord drecord object holding the template (circular or linear) saltc : float, optional saltc = monovalent cations (mM) (Na,K..) default value is 50mM This is used for Tm calculations. fc : float, optional primer concentration (nM) default set to 1000nM = 1µM This is used for Tm calculations. rc : float, optional primer concentration (nM) default set to 1000nM = 1µM This is used for Tm calculations. ''' def __init__(self, forward_primer, reverse_primer, template, saltc=50, fc=1000, rc=1000): self.forward_primer = forward_primer self.reverse_primer = reverse_primer self.fc = fc self.rc = rc self.saltc = saltc self.template = template self.product = None def __repr__(self): ''' returns a short string representation of the object ''' return "Amplicon({})".format(self.__len__()) def __len__(self): ''' returns the lenght of the PCR product ''' length = len(self.forward_primer.primer) length += len(self.reverse_primer.primer) if self.reverse_primer.pos>self.forward_primer.pos: length += abs(self.reverse_primer.pos-self.forward_primer.pos)-2 else: length += len(self.template)-abs(self.reverse_primer.pos-self.forward_primer.pos)-2 return length
[docs] def pcr_product(self): '''Returns the PCR product as a drecord object. Primers are marked as SeqFeatures(Biopython) associated to the sequence. ''' if self.product: return self.product begin=self.forward_primer.pos-len(self.forward_primer.footprint)+1 end =self.reverse_primer.pos+len(self.reverse_primer.footprint)-1 if self.template.circular: tmpl=copy.deepcopy(self.template) tmpl.linear = True tmpl=tmpl+tmpl else: tmpl=self.template if begin<0: begin = len(tmpl)/2+begin if begin >= end: end=end+len(tmpl)/2 prd = (drecord(self.forward_primer.tail) + tmpl[begin:end] + drecord(self.reverse_primer.tail.reverse_complement())) # description = Genbank LOCUS max 16 chars prd.name = "{0}bp_PCR_prod".format(len(prd))[:16] prd.id = "{0}bp {1}".format( str(len(prd))[:14],seguid(prd.seq) ) prd.description="Primers {0} {1}".format( self.forward_primer.primer.name, self.reverse_primer.primer.name) prd.features.append(SeqFeature(FeatureLocation(0,len(self.forward_primer.primer)), type ="primer_bind",strand = 1, qualifiers = {"note":self.forward_primer.primer.name})) prd.features.append(SeqFeature(FeatureLocation(len(prd) - len(self.reverse_primer.primer),len(prd)), type ="primer_bind", strand = -1, qualifiers = {"note":self.reverse_primer.primer.name})) self.product=prd return self.product
[docs] def flankup(self,flankuplength=50): ''' returns a drecord object containing flankuplength bases upstream of the forward primer footprint, truncated if the template is not long enough. :: <--- flankup ---> 5TAATAAactactgactatct3 |||||||||||||| acgcattcagctactgtactactgactatctatcg ''' return self.template.seq[self.forward_primer.pos-flankuplength-len(self.forward_primer.footprint):self.forward_primer.pos-len(self.forward_primer.footprint)]
[docs] def flankdn(self,flankdnlength=50): ''' returns a drecord object containing flankdnlength bases downstream of the reverse primer footprint truncated if the template is not long enough. :: <---- flankdn ------> 3actactgactatctTAATAA5 |||||||||||||| acgcattcagctactgtactactgactatctatcgtacatgtactatcgtat ''' return self.template.seq[self.reverse_primer.pos+len(self.reverse_primer.footprint):self.reverse_primer.pos+flankdnlength+len(self.reverse_primer.footprint)]
def _tm(self): '''Tm calculations according to SantaLucia 1998 Four variables are set. ''' self.tmf = Tm_staluc(str(self.forward_primer.footprint),dnac=50, saltc=self.saltc) self.tmr = Tm_staluc(str(self.reverse_primer.footprint),dnac=50, saltc=self.saltc) ''' Ta calculation for enzymes with dsDNA binding domains (dbd) like Pfu-Sso7d, Phusion or Phire https://www.finnzymes.fi/tm_determination.html ''' self.tmf_dbd = tmbresluc(str(self.forward_primer.footprint),primerc=self.fc) self.tmr_dbd = tmbresluc(str(self.reverse_primer.footprint),primerc=self.rc)
[docs] def detailed_figure(self): ''' Returns ------- figure:string A string containing a text representation of the primers annealing on the template. Notes ----- tm is the melting temperature (Tm) calculated according to SantaLucia 1998 [1] for each primer. (dbd) is Tm calculation for enzymes with dsDNA binding domains like Pfu-Sso7d [2]. See [3] for more information. References ---------- .. [1] J. SantaLucia, “A Unified View of Polymer, Dumbbell, and Oligonucleotide DNA Nearest-neighbor Thermodynamics,” Proceedings of the National Academy of Sciences 95, no. 4 (1998): 1460. .. [2] M. Nørholm, “A Mutant Pfu DNA Polymerase Designed for Advanced Uracil-excision DNA Engineering,” BMC Biotechnology 10, no. 1 (2010): 21, doi:10.1186/1472-6750-10-21. .. [3] http://www.thermoscientificbio.com/webtools/tmc/ :: 5gctactacacacgtactgactg3 |||||||||||||||||||||| tm 52.6 (dbd) 58.3 5gctactacacacgtactgactg...caagatagagtcagtaaccaca3 3cgatgatgtgtgcatgactgac...gttctatctcagtcattggtgt5 |||||||||||||||||||||| tm 49.1 (dbd) 57.7 3gttctatctcagtcattggtgt5 ''' self._tm() f = ''' 5{fp}3 {fap:>{fplength}} tm {tmf} (dbd) {tmf_dbd} {sp}5{faz}...{raz}3 {sp}3{fzc}...{rzc}5 {sp2}{rap} tm {tmr} (dbd) {tmr_dbd} {sp2}3{rp}5 '''.format( fp = self.forward_primer.primer.seq, fap = "|"*len(self.forward_primer.footprint), fplength = len(self.forward_primer.primer.seq), tmf = round(self.tmf,1), tmr = round(self.tmr,1), tmf_dbd = round(self.tmf_dbd,1), tmr_dbd = round(self.tmr_dbd,1), rp = self.reverse_primer.primer.seq[::-1], rap = "|"*len(self.reverse_primer.footprint), rplength = len(self.reverse_primer.primer.seq), faz = self.forward_primer.footprint, raz = self.reverse_primer.footprint.reverse_complement(), fzc = self.forward_primer.footprint.complement(), rzc = self.reverse_primer.footprint[::-1], sp = " "*(len(self.forward_primer.primer.seq)-len(self.forward_primer.footprint)), sp2 = " "*(3+len(self.forward_primer.primer.seq)) ) return textwrap.dedent(f).strip()
[docs] def pcr_program(self): '''Returns a string containing a text representation of a proposed PCR program :: Taq (rate 30 nt/s) Three-step| 30 cycles | |SantaLucia 1998 94.0°C |94.0°C | |SaltC 50mM __________|_____ 72.0°C |72.0°C| 04min00s |30s \ ________|______| | \ 46.0°C/ 0min 1s|10min | | \_____/ | | | 30s | |4-8°C Pfu-Sso7d (rate 15s/kb) Three-step| 30 cycles | |Breslauer1986,SantaLucia1998 98.0°C |98.0°C | |SaltC 50mM __________|_____ 72.0°C |72.0°C|Primer1C 1µM 00min30s |10s \ 61.0°C ________|______|Primer2C 1µM | \______/ 0min 0s|10min | | 10s | |4-8°C ''' self._tm() if not self.product: self.pcr_product() # Ta calculation according to # Rychlik, Spencer, and Rhoads, 1990, Optimization of the anneal # ing temperature for DNA amplification in vitro # http://www.ncbi.nlm.nih.gov/pubmed/2003928 GC_prod=GC(str(self.product.seq)) tml = min(self.tmf,self.tmr) #print GC(str(self.product.seq)), self.saltc/1000.0, len(self.product) tmp = 81.5 + 0.41*GC(str(self.product.seq)) + 16.6*log10(self.saltc/1000.0) - 675/len(self.product) ta = 0.3*tml+0.7*tmp-14.9 # Fermentas recombinant taq taq_extension_rate = 30 # seconds/kB PCR product length extension_time_taq = taq_extension_rate * len(self.product) / 1000 # seconds f = textwrap.dedent(u''' Taq (rate {rate} nt/s) Three-step| 30 cycles | |SantaLucia 1998 94.0°C |94.0°C | |SaltC {saltc:2}mM __________|_____ 72.0°C |72.0°C| 04min00s |30s \ ________|______| | \ {ta}°C/{0:2}min{1:2}s|10min | | \_____/ | | | 30s | |4-8°C '''.format(rate = taq_extension_rate, ta = math.ceil(ta), saltc = self.saltc, *divmod(extension_time_taq,60))) PfuSso7d_extension_rate = 15 #seconds/kB PCR product extension_time_PfuSso7d = PfuSso7d_extension_rate * len(self.product) / 1000 # seconds # Ta calculation for enzymes with dsDNA binding domains like Pfu-Sso7d # https://www.finnzymes.fi/tm_determination.html length_of_f = len(self.forward_primer.footprint) length_of_r = len(self.reverse_primer.footprint) if (length_of_f>20 and length_of_r>20 and self.tmf_dbd>=69.0 and self.tmr_dbd>=69.0) or (self.tmf_dbd>=72.0 and self.tmr_dbd>=72.0): f+=textwrap.dedent( u''' Pfu-Sso7d (rate {rate}s/kb) Two-step| 30 cycles | |Breslauer1986,SantaLucia1998 98.0°C |98.0C | |SaltC {saltc:2}mM _____ __|_____ | |Primer1C {fc:3}µM 00min30s|10s \ 72.0°C|72.0°C|Primer2C {rc:3}µM | \_______|______| | {0:2}min{1:2}s|10min |4-8°C '''.format(rate = PfuSso7d_extension_rate, fc = self.fc, rc = self.rc, saltc = self.saltc, *divmod(extension_time_PfuSso7d,60))) else: if (length_of_f>20 and length_of_r>20): ta = min(self.tmf_dbd,self.tmr_dbd)+3 else: ta = min(self.tmf_dbd,self.tmr_dbd) f+=textwrap.dedent( u''' Pfu-Sso7d (rate {rate}s/kb) Three-step| 30 cycles | |Breslauer1986,SantaLucia1998 98.0°C |98.0°C | |SaltC {saltc:2}mM __________|_____ 72.0°C |72.0°C|Primer1C {fc:3}µM 00min30s |10s \ {ta}°C ________|______|Primer2C {rc:3}µM | \______/{0:2}min{1:2}s|10min | | 10s | |4-8°C '''.format(rate = PfuSso7d_extension_rate, ta = math.ceil(ta), fc = self.fc/1000, rc = self.rc/1000, saltc= self.saltc, *divmod(extension_time_PfuSso7d,60))) return f
[docs]class Anneal: ''' Returns a list of Amplicon objects, one for each primer pair that may from a PCR product. Parameters ---------- primers : iterable containing SeqRecord objects Primer sequences 5'-3' template : string, Seq, SeqRecord or drecord object with The template sequence 5'-3' homology_limit : int, optional limit length of the annealing part of the primers. max_product_size: int, optional PCR products longer than max_product_size are not reported Attributes ---------- amplicons : list of Amplicon objects All possible primer pairs give rise to a amplicon object in the amplicons property. ''' def __init__(self, primers, template, homology_limit=13, max_product_size=15000): self.homology_limit = homology_limit new=[] primers=[p for p in primers if p.seq] self.template = drecord(template) tm = str(self.template.seq).lower() rc = str(self.template.rc().seq).lower() length = len(tm) primer = collections.namedtuple("primer","primer pos footprint tail") self.fwd_primers = [] self.rev_primers = [] self.amplicons = [] tm = str(template.seq) tm_rc = str(template.seq.reverse_complement()) if not self.template.circular: for p in primers: self.fwd_primers.extend((primer(p, pos, Seq(fp), Seq(tl)) for pos, fp, tl in _annealing_positions( p.seq.tostring(), tm, homology_limit))) self.rev_primers.extend((primer(p,len(template)-pos, Seq(fp), Seq(tl)) for pos, fp, tl in _annealing_positions( p.seq.tostring(), tm_rc, homology_limit))) else: self.template2=copy.deepcopy(template) self.template2.linear=True self.template2 = self.template2 + self.template2 ct = 2*tm ct_rc = 2*tm_rc for p in primers: ann1 = _annealing_positions(p.seq.tostring(), tm, homology_limit) ann2 = _annealing_positions(p.seq.tostring(), ct, homology_limit) ann = set(ann2) - set(ann1) ann = [primer(p, pos%len(template), Seq(fp), Seq(tl)) for (pos, fp, tl) in ann] self.fwd_primers.extend(ann) ann1 = _annealing_positions(p.seq.tostring(), tm_rc, homology_limit) ann2 = _annealing_positions(p.seq.tostring(), ct_rc, homology_limit) ann = set(ann2) - set(ann1) ann = [primer(p, len(template)-pos%len(template), Seq(fp), Seq(tl)) for (pos, fp, tl) in ann] self.rev_primers.extend(ann) for fp in self.fwd_primers: for rp in self.rev_primers: if (0 < rp.pos-fp.pos < max_product_size): self.amplicons.append(Amplicon(fp,rp, self.template)) elif self.template.circular and fp.pos>rp.pos and len(template)-fp.pos-rp.pos < max_product_size: self.amplicons.append(Amplicon(fp, rp, self.template)) ### changed here 2
[docs] def report(self): ''' annealobj.report() is an alias of str(annealobj) ''' return self.__str__()
def __repr__(self): ''' return a short string represenation ''' return "Anneal(amplicons = {})".format(len(self.amplicons)) def __str__(self): '''return a short report describing if or where primer anneal on the template. ''' mystring = "Template {name} {size} nt {top}:\n".format(name=self.template.name, size=len(self.template), top={True:"circular", False:"linear"}[self.template.circular] ) if self.fwd_primers: for p in self.fwd_primers: mystring += "Primer {name} anneals at position {pos}\n".format(name=p.primer.name, pos=p.pos) else: mystring += "No forward primers anneal...\n" if self.rev_primers: for p in self.rev_primers: mystring += "Primer {name} anneals reverse at position {pos}\n".format(name=p.primer.name, pos=p.pos) else: mystring += "No reverse primers anneal...\n" return mystring.strip()
[docs] def products(self): ''' returns all pcr product as a list of drecords ''' return [a.product for a in self.amplicons]
[docs] def featured_template(self): '''returns the template drecord object with the fotprint of all annealing primers marked as SeqFeatures ''' template = self.template for primer in self.fwd_primers: if primer.pos-len(primer.footprint)>0: start = primer.pos-len(primer.footprint) end = primer.pos template.features.append(SeqFeature(FeatureLocation(start,end+1),type ="primer_bind",strand = 1, qualifiers = {"note":fp.name,"ApEinfo_fwdcolor":"green","ApEinfo_revcolor":"red"})) else: start = len(template)-len(primer.footprint)+primer.pos end = start+len(primer.footprint)-len(template) suba = SeqFeature( FeatureLocation(start,len(template)), type ="primer_bind", strand = 1, qualifiers = {"note":primer.primer.name} ) subb = SeqFeature( FeatureLocation(0,end), type ="primer_bind", strand = 1, qualifiers = {"note":primer.primer.name}) template.features.append(SeqFeature(FeatureLocation(start,end), type ="primer_bind", sub_features = [suba,subb], location_operator= "join", strand = 1, qualifiers = {"note":primer.primer.name})) for primer in self.rev_primers: if primer.pos+len(primer.footprint)<=len(template): start = primer.pos end = primer.pos + len(footprint) template.features.append(SeqFeature(FeatureLocation(start-1,end),type ="primer_bind",strand = -1, qualifiers = {"note":rp.name,"ApEinfo_fwdcolor":"green","ApEinfo_revcolor":"red"})) else: start = primer.pos end = primer.pos+len(primer.footprint)-len(template) suba = SeqFeature(FeatureLocation(start,len(template)), type ="primer_bind", strand = -1, qualifiers = {"note":primer.primer.name}) subb = SeqFeature(FeatureLocation(0,end), type ="primer_bind", strand = -1, qualifiers = {"note":primer.primer.name,}) template.features.append(SeqFeature(FeatureLocation(start,end), type ="primer_bind", sub_features = [suba,subb], location_operator= "join", strand = -1, qualifiers = {"note":primer.primer.name})) return template
[docs]def pcr(*args,**kwargs): '''pcr is a convenience function for Anneal to simplify its usage, especially from the command line. If more than one PCR product is formed, an exception is raised. args is any iterable of sequences or an iterable of iterables of sequences. args will be greedily flattened. Parameters ---------- args : iterable containing sequence objects Several arguments are also accepted. limit : int = 13, optional limit length of the annealing part of the primers. Notes ----- sequences in args could be of type: string Seq SeqRecord drecord The last sequence will be interpreted as the template all preceeding sequences as primers. This is a powerful function, use with care! Returns ------- product : drecord a drecord object representing the PCR product. The direction of the PCR product will be the same as for the template sequence. ''' import itertools from Bio.SeqRecord import SeqRecord ''' flatten args ''' output = [] stack = [] stack.extend(reversed(args)) while stack: top = stack.pop() if hasattr(top, "__iter__") and not isinstance(top, SeqRecord): stack.extend(reversed(top)) else: output.append(top) new=[] for s in output: if isinstance(s, Seq): s = SeqRecord(s) elif isinstance(s, SeqRecord): pass elif hasattr(s, "watson"): s=s.watson elif isinstance(s, basestring): s = SeqRecord(Seq(s)) else: raise TypeError("the record property needs to be a string, a Seq object or a SeqRecord object") new.append(s) anneal_primers = Anneal(new[:-1], new[-1], **kwargs) if anneal_primers: if len(anneal_primers.amplicons)==1: return anneal_primers.amplicons.pop().pcr_product() elif len(anneal_primers.amplicons)==0: raise Exception("No PCR products! {}".format(anneal_primers.report())) else: raise Exception("PCR not specific! {}".format(anneal_primers.report())) else: raise Exception(anneal_primers.report()) return
[docs]def basictm(primer): '''Returns the melting temperature (Tm) of the primer using the basic formula. | Tm = (wA+xT)*2 + (yG+zC)*4 assumed 50mM monovalent cations | | w = number of A in primer | x = number of T in primer | y = number of G in primer | z = number of C in primer Parameters ---------- primer : string Primer sequence 5'-3' Returns ------- tm : int Examples -------- >>> from pydna.amplify import basictm >>> basictm("ggatcc") 20 >>> ''' primer = str(primer).lower() return (primer.count("a") + primer.count("t"))*2 + (primer.count("g") + primer.count("c"))*4 # http://www.promega.com/techserv/tools/biomath/calc11.htm#melt_results
[docs]def tmstaluc98(primer,dnac=50,saltc=50): '''Returns the melting temperature (Tm) of the primer using the nearest neighbour algorithm. Formula and thermodynamic data is taken from SantaLucia 1998. This implementation gives the same answer as the one provided by Biopython (See Examples). Thermodynamic data used: ===== ==== ==== pair dH dS ===== ==== ==== AA/TT 7.9 22.2 AT/TA 7.2 20.4 TA/AT 7.2 21.3 CA/GT 8.5 22.7 GT/CA 8.4 22.4 CT/GA 7.8 21.0 GA/CT 8.2 22.2 CG/GC 10.6 27.2 GC/CG 9.8 24.4 GG/CC 8.0 19.9 ===== ==== ==== Parameters ---------- primer : string Primer sequence 5'-3' in UPPERCASE Returns ------- tm : float tm of the primer References ---------- .. [1] J. SantaLucia, “A Unified View of Polymer, Dumbbell, and Oligonucleotide DNA Nearest-neighbor Thermodynamics,” Proceedings of the National Academy of Sciences 95, no. 4 (1998): 1460. Examples: --------- >>> from pydna.amplify import tmstaluc98 >>> from Bio.SeqUtils.MeltingTemp import Tm_staluc >>> tmstaluc98("ACGTCATCGACACTATCATCGAC") 54.55597724052518 >>> Tm_staluc("ACGTCATCGACACTATCATCGAC") 54.555977240525124 >>> ''' nntermsl={ "AA": (7.9 , 22.2), "TT": (7.9 , 22.2), "AT": (7.2 , 20.4), "TA": (7.2 , 21.3), "CA": (8.5 , 22.7), "TG": (8.5 , 22.7), "GT": (8.4 , 22.4), "AC": (8.4 , 22.4), "CT": (7.8 , 21.0), "AG": (7.8 , 21.0), "GA": (8.2 , 22.2), "TC": (8.2 , 22.2), "CG": (10.6 , 27.2), "GC": (9.8 , 24.4), "GG": (8 , 19.9), "CC": (8 , 19.9), "A" : (0 , 0 ), "C" : (0 , 0 ), "G" : (0 , 0 ), "T" : (0 , 0 ) } helixinit = { "G": (-0.1 ,2.8), "C": (-0.1 ,2.8), "A": (-2.3, -4.1), "T": (-2.3, -4.1) } dH, dS = helixinit[primer[0]] H , S = helixinit[primer[-1]] dH = dH+H dS = dS+S for p in range(len(primer)): dn = primer[p:p+2] H,S = nntermsl[dn] dH+=H dS+=S R = 1.987 # universal gas constant in Cal/degrees C*Mol k = (dnac/4.0)*1e-9 dS = dS-0.368*(len(primer)-1)*math.log(saltc/1e3) tm = ((1000* (-dH))/(-dS+(R * (math.log(k)))))-273.15 return tm
[docs]def tmbreslauer86(primer,dnac=500.0,saltc=50.0,thermodynamics=False): '''Returns the melting temperature (Tm) of the primer using the nearest neighbour algorithm. Formula and thermodynamic data is taken from Breslauer 1986. These data are no longer widely used. Breslauer 1986, table 2 [1] ===== ===== ==== === pair dH dS dG ===== ===== ==== === AA/TT 9.1 24.0 1.9 AT/TA 8.6 23.9 1.5 TA/AT 6.0 16.9 0.9 CA/GT 5.8 12.9 1.9 GT/CA 6.5 17.3 1.3 CT/GA 7.8 20.8 1.6 GA/CT 5.6 13.5 1.6 CG/GC 11.9 27.8 3.6 GC/CG 11.1 26.7 3.1 GG/CC 11.0 26.6 3.1 ===== ===== ==== === Parameters ---------- primer : string Primer sequence 5'-3' in UPPERCASE Returns ------- tm : float References ---------- .. [1] K.J. Breslauer et al., “Predicting DNA Duplex Stability from the Base Sequence,” Proceedings of the National Academy of Sciences 83, no. 11 (1986): 3746. Examples: --------- >>> from pydna.amplify import tmbreslauer86 >>> tmbreslauer86("ACGTCATCGACACTATCATCGAC") 64.28863985851899 ''' nntermbr={ "AA": (9.1 ,24.0 ,1.9), "TT": (9.1 ,24.0 ,1.9), "AT": (8.6 ,23.9 ,1.5), "TA": (6.0 ,16.9 ,0.9), "CA": (5.8 ,12.9 ,1.9), "TG": (5.8 ,12.9 ,1.9), "GT": (6.5 ,17.3 ,1.3), "AC": (6.5 ,17.3 ,1.3), "CT": (7.8 ,20.8 ,1.6), "AG": (7.8 ,20.8 ,1.6), "GA": (5.6 ,13.5 ,1.6), "TC": (5.6 ,13.5 ,1.6), "CG": (11.9 ,27.8 ,3.6), "GC": (11.1 ,26.7 ,3.1), "GG": (11.0 ,26.6 ,3.1), "CC": (11.0 ,26.6 ,3.1), "A" : (0 , 0 ,0), "C" : (0 , 0 ,0), "G" : (0 , 0 ,0), "T" : (0 , 0 ,0), } dH=3.4 dS=12.4 dG=0 for p in range(len(primer)): dn = primer[p:p+2] H,S,G = nntermbr[dn] dG+=G dH+=H dS+=S R = 1.9872 # universal gas constant in Cal/degrees C*Mol k = dnac*1E-9/2.0 dH = dH - 5 dS = dS-0.368*(len(primer)-1)*math.log(saltc/1E3) # SantaLucia salt correction formula tm = 1000 * -dH /(-dS + R * math.log(k) ) - 273.15 # degrees Celsius if thermodynamics: return tm,dH,dS else: return tm
[docs]def tmbresluc(primer, primerc=500.0, saltc=50.0, thermodynamics=False): '''Returns the tm for a primer using a formula adapted to polymerases with a DNA binding domain. Parameters ---------- primer : string primer sequence 5'-3' primerc : float concentration (nM) saltc : float, optional Monovalent cation concentration (mM) thermodynamics : bool, optional prints details of the thermodynamic data to stdout. For debugging only. Returns ------- tm : float the tm of the primer tm,dH,dS : tuple tm and dH and dS used for the calculation ''' import collections dHBr = collections.defaultdict(dict) dSBr = collections.defaultdict(dict) dHBr[0][0] = -9100 dSBr[0][0] = -24 dHBr[0][1] = -7633.3000000000002 dSBr[0][1] = -20.699999999999999 dHBr[0][2] = -6500 dSBr[0][2] = -17.300000000000001 dHBr[0][3] = -8500 dSBr[0][3] = -22.899999999999999 dHBr[0][6] = -7800 dSBr[0][6] = -20.800000000000001 dHBr[0][7] = -8066.6999999999998 dSBr[0][7] = -21.699999999999999 dHBr[0][10] = -8200 dSBr[0][10] = -22.399999999999999 dHBr[0][12] = -7800 dSBr[0][12] = -20.699999999999999 dHBr[0][13] = -8000 dSBr[0][13] = -21.5 dHBr[0][17] = -8450 dSBr[0][17] = -22.399999999999999 dHBr[0][18] = -7150 dSBr[0][18] = -19.100000000000001 dHBr[0][19] = -8600 dSBr[0][19] = -23.899999999999999 dHBr[0][21] = -7800 dSBr[0][21] = -20.699999999999999 dHBr[0][22] = -8850 dSBr[0][22] = -24 dHBr[0][23] = -8000 dSBr[0][23] = -21.5 dHBr[0][24] = -7550 dSBr[0][24] = -20.600000000000001 dHBr[1][0] = -5800 dSBr[1][0] = -14.4 dHBr[1][1] = -8866.7000000000007 dSBr[1][1] = -21.800000000000001 dHBr[1][2] = -9233.2999999999993 dSBr[1][2] = -22.300000000000001 dHBr[1][3] = -7722.1999999999998 dSBr[1][3] = -19.199999999999999 dHBr[1][6] = -9566.7000000000007 dSBr[1][6] = -22.399999999999999 dHBr[1][7] = -7611.1000000000004 dSBr[1][7] = -19.100000000000001 dHBr[1][10] = -8683.2999999999993 dSBr[1][10] = -21.600000000000001 dHBr[1][12] = -7516.6999999999998 dSBr[1][12] = -18.399999999999999 dHBr[1][13] = -8100 dSBr[1][13] = -20 dHBr[1][17] = -7683.3000000000002 dSBr[1][17] = -18.399999999999999 dHBr[1][18] = -9400 dSBr[1][18] = -22.399999999999999 dHBr[1][19] = -7800 dSBr[1][19] = -20.699999999999999 dHBr[1][21] = -8200 dSBr[1][21] = -19.699999999999999 dHBr[1][22] = -6800 dSBr[1][22] = -17.600000000000001 dHBr[1][23] = -8100 dSBr[1][23] = -20 dHBr[1][24] = -8516.7000000000007 dSBr[1][24] = -21.5 dHBr[2][0] = -5800 dSBr[2][0] = -12.9 dHBr[2][1] = -10233.299999999999 dSBr[2][1] = -25.100000000000001 dHBr[2][2] = -11000 dSBr[2][2] = -26.600000000000001 dHBr[2][3] = -8500 dSBr[2][3] = -20.5 dHBr[2][6] = -11900 dSBr[2][6] = -27.800000000000001 dHBr[2][7] = -8200 dSBr[2][7] = -20.100000000000001 dHBr[2][10] = -9850 dSBr[2][10] = -24.300000000000001 dHBr[2][12] = -8400 dSBr[2][12] = -19.800000000000001 dHBr[2][13] = -9125 dSBr[2][13] = -22 dHBr[2][17] = -8850 dSBr[2][17] = -20.399999999999999 dHBr[2][18] = -11450 dSBr[2][18] = -27.199999999999999 dHBr[2][19] = -7800 dSBr[2][19] = -20.800000000000001 dHBr[2][21] = -9566.7000000000007 dSBr[2][21] = -22.399999999999999 dHBr[2][22] = -6800 dSBr[2][22] = -16.899999999999999 dHBr[2][23] = -9125 dSBr[2][23] = -22 dHBr[2][24] = -9400 dSBr[2][24] = -23.699999999999999 dHBr[3][0] = -6900 dSBr[3][0] = -18.100000000000001 dHBr[3][1] = -8000 dSBr[3][1] = -20.300000000000001 dHBr[3][2] = -7733.3000000000002 dSBr[3][2] = -19.199999999999999 dHBr[3][3] = -7722.1999999999998 dSBr[3][3] = -20 dHBr[3][6] = -8200 dSBr[3][6] = -20.100000000000001 dHBr[3][7] = -7566.6999999999998 dSBr[3][7] = -19.699999999999999 dHBr[3][10] = -8133.3000000000002 dSBr[3][10] = -20.899999999999999 dHBr[3][12] = -7316.6999999999998 dSBr[3][12] = -18.699999999999999 dHBr[3][13] = -7725 dSBr[3][13] = -19.800000000000001 dHBr[3][17] = -7550 dSBr[3][17] = -19.100000000000001 dHBr[3][18] = -7966.6999999999998 dSBr[3][18] = -19.600000000000001 dHBr[3][19] = -8066.6999999999998 dSBr[3][19] = -21.699999999999999 dHBr[3][21] = -7611.1000000000004 dSBr[3][21] = -19.100000000000001 dHBr[3][22] = -7483.3000000000002 dSBr[3][22] = -19.899999999999999 dHBr[3][23] = -7725 dSBr[3][23] = -19.800000000000001 dHBr[3][24] = -7900 dSBr[3][24] = -20.5 dHBr[6][0] = -5600 dSBr[6][0] = -13.5 dHBr[6][1] = -9533.2999999999993 dSBr[6][1] = -23.5 dHBr[6][2] = -11100 dSBr[6][2] = -26.699999999999999 dHBr[6][3] = -7700 dSBr[6][3] = -19.100000000000001 dHBr[6][6] = -11000 dSBr[6][6] = -26.600000000000001 dHBr[6][7] = -7733.3000000000002 dSBr[6][7] = -19.199999999999999 dHBr[6][10] = -8750 dSBr[6][10] = -22 dHBr[6][12] = -8350 dSBr[6][12] = -20.100000000000001 dHBr[6][13] = -8550 dSBr[6][13] = -21 dHBr[6][17] = -8300 dSBr[6][17] = -20.100000000000001 dHBr[6][18] = -11050 dSBr[6][18] = -26.699999999999999 dHBr[6][19] = -6500 dSBr[6][19] = -17.300000000000001 dHBr[6][21] = -9233.2999999999993 dSBr[6][21] = -22.300000000000001 dHBr[6][22] = -6050 dSBr[6][22] = -15.4 dHBr[6][23] = -8550 dSBr[6][23] = -21 dHBr[6][24] = -8800 dSBr[6][24] = -22 dHBr[7][0] = -6966.6999999999998 dSBr[7][0] = -17.899999999999999 dHBr[7][1] = -8233.2999999999993 dSBr[7][1] = -20.800000000000001 dHBr[7][2] = -7700 dSBr[7][2] = -19.100000000000001 dHBr[7][3] = -7988.8999999999996 dSBr[7][3] = -20.399999999999999 dHBr[7][6] = -8500 dSBr[7][6] = -20.5 dHBr[7][7] = -7722.1999999999998 dSBr[7][7] = -20 dHBr[7][10] = -8500 dSBr[7][10] = -21.699999999999999 dHBr[7][12] = -7333.3000000000002 dSBr[7][12] = -18.5 dHBr[7][13] = -7916.6999999999998 dSBr[7][13] = -20.100000000000001 dHBr[7][17] = -7733.3000000000002 dSBr[7][17] = -19.199999999999999 dHBr[7][18] = -8100 dSBr[7][18] = -19.800000000000001 dHBr[7][19] = -8500 dSBr[7][19] = -22.899999999999999 dHBr[7][21] = -7722.1999999999998 dSBr[7][21] = -19.199999999999999 dHBr[7][22] = -7733.3000000000002 dSBr[7][22] = -20.399999999999999 dHBr[7][23] = -7916.6999999999998 dSBr[7][23] = -20.100000000000001 dHBr[7][24] = -8100 dSBr[7][24] = -21 dHBr[10][0] = -5800 dSBr[10][0] = -15.199999999999999 dHBr[10][1] = -8183.3000000000002 dSBr[10][1] = -20.199999999999999 dHBr[10][2] = -8350 dSBr[10][2] = -20.100000000000001 dHBr[10][3] = -7333.3000000000002 dSBr[10][3] = -18.5 dHBr[10][6] = -8400 dSBr[10][6] = -19.800000000000001 dHBr[10][7] = -7316.6999999999998 dSBr[10][7] = -18.699999999999999 dHBr[10][10] = -8100 dSBr[10][10] = -20.199999999999999 dHBr[10][12] = -7075 dSBr[10][12] = -17.699999999999999 dHBr[10][13] = -7587.5 dSBr[10][13] = -18.899999999999999 dHBr[10][17] = -7100 dSBr[10][17] = -17.5 dHBr[10][18] = -8375 dSBr[10][18] = -19.899999999999999 dHBr[10][19] = -7800 dSBr[10][19] = -20.699999999999999 dHBr[10][21] = -7516.6999999999998 dSBr[10][21] = -18.399999999999999 dHBr[10][22] = -6800 dSBr[10][22] = -17.899999999999999 dHBr[10][23] = -7587.5 dSBr[10][23] = -18.899999999999999 dHBr[10][24] = -8075 dSBr[10][24] = -20.399999999999999 dHBr[12][0] = -7450 dSBr[12][0] = -18.5 dHBr[12][1] = -8933.2999999999993 dSBr[12][1] = -22.899999999999999 dHBr[12][2] = -8750 dSBr[12][2] = -22 dHBr[12][3] = -8500 dSBr[12][3] = -21.699999999999999 dHBr[12][6] = -9850 dSBr[12][6] = -24.300000000000001 dHBr[12][7] = -8133.3000000000002 dSBr[12][7] = -20.899999999999999 dHBr[12][10] = -9025 dSBr[12][10] = -23.300000000000001 dHBr[12][12] = -8100 dSBr[12][12] = -20.199999999999999 dHBr[12][13] = -8562.5 dSBr[12][13] = -21.800000000000001 dHBr[12][17] = -8650 dSBr[12][17] = -21.399999999999999 dHBr[12][18] = -9300 dSBr[12][18] = -23.100000000000001 dHBr[12][19] = -8200 dSBr[12][19] = -22.399999999999999 dHBr[12][21] = -8683.2999999999993 dSBr[12][21] = -21.600000000000001 dHBr[12][22] = -7825 dSBr[12][22] = -20.399999999999999 dHBr[12][23] = -8562.5 dSBr[12][23] = -21.800000000000001 dHBr[12][24] = -8475 dSBr[12][24] = -22.199999999999999 dHBr[13][0] = -6625 dSBr[13][0] = -16.800000000000001 dHBr[13][1] = -8558.2999999999993 dSBr[13][1] = -21.5 dHBr[13][2] = -8550 dSBr[13][2] = -21 dHBr[13][3] = -7916.6999999999998 dSBr[13][3] = -20.100000000000001 dHBr[13][6] = -9125 dSBr[13][6] = -22 dHBr[13][7] = -7725 dSBr[13][7] = -19.800000000000001 dHBr[13][10] = -8562.5 dSBr[13][10] = -21.800000000000001 dHBr[13][12] = -7587.5 dSBr[13][12] = -18.899999999999999 dHBr[13][13] = -8075 dSBr[13][13] = -20.300000000000001 dHBr[13][17] = -7875 dSBr[13][17] = -19.399999999999999 dHBr[13][18] = -8837.5 dSBr[13][18] = -21.5 dHBr[13][19] = -8000 dSBr[13][19] = -21.5 dHBr[13][21] = -8100 dSBr[13][21] = -20 dHBr[13][22] = -7312.5 dSBr[13][22] = -19.199999999999999 dHBr[13][23] = -8075 dSBr[13][23] = -20.300000000000001 dHBr[13][24] = -8275 dSBr[13][24] = -21.300000000000001 dHBr[17][0] = -7350 dSBr[17][0] = -18.800000000000001 dHBr[17][1] = -8583.2999999999993 dSBr[17][1] = -22.100000000000001 dHBr[17][2] = -8800 dSBr[17][2] = -22 dHBr[17][3] = -8100 dSBr[17][3] = -21 dHBr[17][6] = -9400 dSBr[17][6] = -23.699999999999999 dHBr[17][7] = -7900 dSBr[17][7] = -20.5 dHBr[17][10] = -8475 dSBr[17][10] = -22.199999999999999 dHBr[17][12] = -8075 dSBr[17][12] = -20.399999999999999 dHBr[17][13] = -8275 dSBr[17][13] = -21.300000000000001 dHBr[17][17] = -8375 dSBr[17][17] = -21.199999999999999 dHBr[17][18] = -9100 dSBr[17][18] = -22.899999999999999 dHBr[17][19] = -7550 dSBr[17][19] = -20.600000000000001 dHBr[17][21] = -8516.7000000000007 dSBr[17][21] = -21.5 dHBr[17][22] = -7450 dSBr[17][22] = -19.699999999999999 dHBr[17][23] = -8275 dSBr[17][23] = -21.300000000000001 dHBr[17][24] = -8175 dSBr[17][24] = -21.300000000000001 dHBr[18][0] = -5700 dSBr[18][0] = -13.199999999999999 dHBr[18][1] = -9883.2999999999993 dSBr[18][1] = -24.300000000000001 dHBr[18][2] = -11050 dSBr[18][2] = -26.699999999999999 dHBr[18][3] = -8100 dSBr[18][3] = -19.800000000000001 dHBr[18][6] = -11450 dSBr[18][6] = -27.199999999999999 dHBr[18][7] = -7966.6999999999998 dSBr[18][7] = -19.600000000000001 dHBr[18][10] = -9300 dSBr[18][10] = -23.100000000000001 dHBr[18][12] = -8375 dSBr[18][12] = -19.899999999999999 dHBr[18][13] = -8837.5 dSBr[18][13] = -21.5 dHBr[18][17] = -8575 dSBr[18][17] = -20.199999999999999 dHBr[18][18] = -11250 dSBr[18][18] = -26.899999999999999 dHBr[18][19] = -7150 dSBr[18][19] = -19.100000000000001 dHBr[18][21] = -9400 dSBr[18][21] = -22.399999999999999 dHBr[18][22] = -6425 dSBr[18][22] = -16.100000000000001 dHBr[18][23] = -8837.5 dSBr[18][23] = -21.5 dHBr[18][24] = -9100 dSBr[18][24] = -22.899999999999999 dHBr[19][0] = -6000 dSBr[19][0] = -16.899999999999999 dHBr[19][1] = -6833.3000000000002 dSBr[19][1] = -16.800000000000001 dHBr[19][2] = -5600 dSBr[19][2] = -13.5 dHBr[19][3] = -6966.6999999999998 dSBr[19][3] = -17.899999999999999 dHBr[19][6] = -5800 dSBr[19][6] = -12.9 dHBr[19][7] = -6900 dSBr[19][7] = -18.100000000000001 dHBr[19][10] = -7450 dSBr[19][10] = -18.5 dHBr[19][12] = -5800 dSBr[19][12] = -15.199999999999999 dHBr[19][13] = -6625 dSBr[19][13] = -16.800000000000001 dHBr[19][17] = -5900 dSBr[19][17] = -14.9 dHBr[19][18] = -5700 dSBr[19][18] = -13.199999999999999 dHBr[19][19] = -9100 dSBr[19][19] = -24 dHBr[19][21] = -5800 dSBr[19][21] = -14.4 dHBr[19][22] = -7550 dSBr[19][22] = -20.5 dHBr[19][23] = -6625 dSBr[19][23] = -16.800000000000001 dHBr[19][24] = -7350 dSBr[19][24] = -18.800000000000001 dHBr[21][0] = -6833.3000000000002 dSBr[21][0] = -16.800000000000001 dHBr[21][1] = -9133.2999999999993 dSBr[21][1] = -23.100000000000001 dHBr[21][2] = -9533.2999999999993 dSBr[21][2] = -23.5 dHBr[21][3] = -8233.2999999999993 dSBr[21][3] = -20.800000000000001 dHBr[21][6] = -10233.299999999999 dSBr[21][6] = -25.100000000000001 dHBr[21][7] = -8000 dSBr[21][7] = -20.300000000000001 dHBr[21][10] = -8933.2999999999993 dSBr[21][10] = -22.899999999999999 dHBr[21][12] = -8183.3000000000002 dSBr[21][12] = -20.199999999999999 dHBr[21][13] = -8558.2999999999993 dSBr[21][13] = -21.5 dHBr[21][17] = -8533.2999999999993 dSBr[21][17] = -20.899999999999999 dHBr[21][18] = -9883.2999999999993 dSBr[21][18] = -24.300000000000001 dHBr[21][19] = -7633.3000000000002 dSBr[21][19] = -20.699999999999999 dHBr[21][21] = -8866.7000000000007 dSBr[21][21] = -21.800000000000001 dHBr[21][22] = -7233.3000000000002 dSBr[21][22] = -18.699999999999999 dHBr[21][23] = -8558.2999999999993 dSBr[21][23] = -21.5 dHBr[21][24] = -8583.2999999999993 dSBr[21][24] = -22.100000000000001 dHBr[22][0] = -7550 dSBr[22][0] = -20.5 dHBr[22][1] = -7233.3000000000002 dSBr[22][1] = -18.699999999999999 dHBr[22][2] = -6050 dSBr[22][2] = -15.4 dHBr[22][3] = -7733.3000000000002 dSBr[22][3] = -20.399999999999999 dHBr[22][6] = -6800 dSBr[22][6] = -16.899999999999999 dHBr[22][7] = -7483.3000000000002 dSBr[22][7] = -19.899999999999999 dHBr[22][10] = -7825 dSBr[22][10] = -20.399999999999999 dHBr[22][12] = -6800 dSBr[22][12] = -17.899999999999999 dHBr[22][13] = -7312.5 dSBr[22][13] = -19.199999999999999 dHBr[22][17] = -7175 dSBr[22][17] = -18.699999999999999 dHBr[22][18] = -6425 dSBr[22][18] = -16.100000000000001 dHBr[22][19] = -8850 dSBr[22][19] = -24 dHBr[22][21] = -6800 dSBr[22][21] = -17.600000000000001 dHBr[22][22] = -8200 dSBr[22][22] = -22.199999999999999 dHBr[22][23] = -7312.5 dSBr[22][23] = -19.199999999999999 dHBr[22][24] = -7450 dSBr[22][24] = -19.699999999999999 dHBr[23][0] = -6625 dSBr[23][0] = -16.800000000000001 dHBr[23][1] = -8558.2999999999993 dSBr[23][1] = -21.5 dHBr[23][2] = -8550 dSBr[23][2] = -21 dHBr[23][3] = -7916.6999999999998 dSBr[23][3] = -20.100000000000001 dHBr[23][6] = -9125 dSBr[23][6] = -22 dHBr[23][7] = -7725 dSBr[23][7] = -19.800000000000001 dHBr[23][10] = -8562.5 dSBr[23][10] = -21.800000000000001 dHBr[23][12] = -7587.5 dSBr[23][12] = -18.899999999999999 dHBr[23][13] = -8075 dSBr[23][13] = -20.300000000000001 dHBr[23][17] = -7875 dSBr[23][17] = -19.399999999999999 dHBr[23][18] = -8837.5 dSBr[23][18] = -21.5 dHBr[23][19] = -8000 dSBr[23][19] = -21.5 dHBr[23][21] = -8100 dSBr[23][21] = -20 dHBr[23][22] = -7312.5 dSBr[23][22] = -19.199999999999999 dHBr[23][23] = -8075 dSBr[23][23] = -20.300000000000001 dHBr[23][24] = -8275 dSBr[23][24] = -21.300000000000001 dHBr[24][0] = -5900 dSBr[24][0] = -14.9 dHBr[24][1] = -8533.2999999999993 dSBr[24][1] = -20.899999999999999 dHBr[24][2] = -8300 dSBr[24][2] = -20.100000000000001 dHBr[24][3] = -7733.3000000000002 dSBr[24][3] = -19.199999999999999 dHBr[24][6] = -8850 dSBr[24][6] = -20.399999999999999 dHBr[24][7] = -7550 dSBr[24][7] = -19.100000000000001 dHBr[24][10] = -8650 dSBr[24][10] = -21.399999999999999 dHBr[24][12] = -7100 dSBr[24][12] = -17.5 dHBr[24][13] = -7875 dSBr[24][13] = -19.399999999999999 dHBr[24][17] = -7375 dSBr[24][17] = -17.600000000000001 dHBr[24][18] = -8575 dSBr[24][18] = -20.199999999999999 dHBr[24][19] = -8450 dSBr[24][19] = -22.399999999999999 dHBr[24][21] = -7683.3000000000002 dSBr[24][21] = -18.399999999999999 dHBr[24][22] = -7175 dSBr[24][22] = -18.699999999999999 dHBr[24][23] = -7875 dSBr[24][23] = -19.399999999999999 dHBr[24][24] = -8375 dSBr[24][24] = -21.199999999999999 saltc = saltc/1000 pri = primerc/10E7 dS = -12.4 dH = -3400 STR = primer.lower(); for i in range(len(STR)-1): n1=ord(STR[i]) n2=ord(STR[i+1]) dH += dHBr[n1 - 97][n2 - 97] dS += dSBr[n1 - 97][n2 - 97] tm = (dH / (1.9872 * math.log(pri / 1600) + dS) + (16.6 * math.log(saltc)) / math.log(10)) - 273.15 if thermodynamics: return tm,dH,dS else: return tm
''' Example ------- >>> from pydna import read >>> from pydna import Anneal >>> template = read(">MyTemplate\\ngctactacacacgtactgactgcctccaagatagagtcagtaaccaca") >>> fp = read(">ForwardPrimer\\ngctactacacacgtactgactg", obj = "SeqRecord") >>> rp = read(">ReversePrimer\\ntgtggttactgactctatcttg", obj = "SeqRecord") >>> primers = (fp,rp) >>> p = Anneal(primers, template) >>> p Anneal(amplicons = 1) >>> print p.report() Template MyTemplate 48 nt linear: Primer ForwardPrimer anneals at position 21 Primer ReversePrimer anneals reverse at position 27 >>> p.amplicons [Amplicon(48)] >>> prod = p.amplicons.pop() >>> prod Amplicon(48) >>> prod.pcr_product() drecord(-48) >>> prod.pcr_product().seq Dseq(-48) gctactacacacgtactgac...agatagagtcagtaaccaca cgatgatgtgtgcatgactg...tctatctcagtcattggtgt >>> print prod.detailed_figure() 5gctactacacacgtactgactg3 |||||||||||||||||||||| tm 52.6 (dbd) 58.3 5gctactacacacgtactgactg...caagatagagtcagtaaccaca3 3cgatgatgtgtgcatgactgac...gttctatctcagtcattggtgt5 |||||||||||||||||||||| tm 49.1 (dbd) 57.7 3gttctatctcagtcattggtgt5 >>> ''' if __name__=="__main__": import doctest doctest.testmod() import textwrap oligos_table_3=''' GCGCGC CGTCGACG GAAGCTTC GGAATTCC GGTATACC GCGAATTCGC CAAAAAG CAAACAAAG CAAAAAAAG CAAATAAAG CAAAGAAAG CGCGTACGCGTACGCG''' for oligo in textwrap.dedent(oligos_table_3).splitlines(): pass #print tmbreslauer86(oligo, thermodynamics = True)[3] oligos = ''' CAGTCAGTACGTACGTGTACTGCCGTA CAGTCAGTACGTACGTGTACTGCCGTAGG CAGTCAGTACGTACGTGTACTGCCG ''' for oligo in textwrap.dedent(oligos).splitlines(): print oligo print _tmbreslauer86(oligo)#, thermodynamics = True) print tmbresluc(oligo) #, thermodynamics = True) print # FZ Primer3Plus # CAGTCAGTACGTACGTGTACTGCCGTA 68.83 68.69 # CAGTCAGTACGTACGTGTACTGCCGTAGG 71.5 71.70 # CAGTCAGTACGTACGTGTACTGCCG 68.7 68.59